IDEAS home Printed from https://ideas.repec.org/a/nat/nature/v410y2001i6829d10.1038_35070620.html
   My bibliography  Save this article

Correction: The limits of selection during maize domestication

Author

Listed:
  • Rong-Lin Wang
  • Adrian Stec
  • Jody Hey
  • Lewis Lukens
  • John Doebley

Abstract

Nature 398 , 236 - 239 (1999 ). The primers used for PCR of the 3′ portion of tb1 amplified a duplicate locus (tb1 homeologue) in two samples (11 and 16). Inclusion of these homeologous sequences caused π to rise sharply at the 3′ end of the gene in Fig. 1. Using a new 3′ primer (gaggcatcatccagcagacgagaaa), tb1 sequences were re-isolated (Genbank accessions AF340187–AF340209).

Suggested Citation

  • Rong-Lin Wang & Adrian Stec & Jody Hey & Lewis Lukens & John Doebley, 2001. "Correction: The limits of selection during maize domestication," Nature, Nature, vol. 410(6829), pages 718-718, April.
  • Handle: RePEc:nat:nature:v:410:y:2001:i:6829:d:10.1038_35070620
    DOI: 10.1038/35070620
    as

    Download full text from publisher

    File URL: https://www.nature.com/articles/35070620
    File Function: Abstract
    Download Restriction: Access to the full text of the articles in this series is restricted.

    File URL: https://libkey.io/10.1038/35070620?utm_source=ideas
    LibKey link: if access is restricted and if your library uses this service, LibKey will redirect you to where you can use your library subscription to access this item
    ---><---

    As the access to this document is restricted, you may want to

    for a different version of it.

    More about this item

    Statistics

    Access and download statistics

    Corrections

    All material on this site has been provided by the respective publishers and authors. You can help correct errors and omissions. When requesting a correction, please mention this item's handle: RePEc:nat:nature:v:410:y:2001:i:6829:d:10.1038_35070620. See general information about how to correct material in RePEc.

    If you have authored this item and are not yet registered with RePEc, we encourage you to do it here. This allows to link your profile to this item. It also allows you to accept potential citations to this item that we are uncertain about.

    We have no bibliographic references for this item. You can help adding them by using this form .

    If you know of missing items citing this one, you can help us creating those links by adding the relevant references in the same way as above, for each refering item. If you are a registered author of this item, you may also want to check the "citations" tab in your RePEc Author Service profile, as there may be some citations waiting for confirmation.

    For technical questions regarding this item, or to correct its authors, title, abstract, bibliographic or download information, contact: Sonal Shukla or Springer Nature Abstracting and Indexing (email available below). General contact details of provider: http://www.nature.com .

    Please note that corrections may take a couple of weeks to filter through the various RePEc services.

    IDEAS is a RePEc service. RePEc uses bibliographic data supplied by the respective publishers.