Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).